Wetenschap - 22 januari 1998

Opheldering van genen in stroomversnelling

Opheldering van genen in stroomversnelling

Opheldering van genen in stroomversnelling
Sequencen verandert werk van moleculair biologen
Massa's gegevens komen momenteel vrij door het grootschalig sequencen van erfelijk materiaal van de mens, planten, dieren en micro-organismen. Moleculair biologen worstelen met enorme hoeveelheden informatie, onbekende genen en nieuwe, grootschalige samenwerkingsverbanden. We leven in een hele spannende tijd, vindt de Groningse onderzoeker dr Sierd Bron
Het is nu nog onvoorstelbaar, maar over een paar jaar is de hele erfelijke code van de mens en van een aantal planten en dieren bekend. Van duizenden nu nog onbekende genen is straks bekend of ze zijn betrokken bij ziekteresistentie, bij de stofwisseling of bij de regulatie van andere genen. Dit alles dankzij het zogeheten sequencen. Honderden laboratoria ontrafelen op dit moment het erfelijk materiaal van een micro-organisme, plant of dier. Ze bepalen systematisch de volgorde van de vier basenparen Adenine (A), Guanine (G), Cytisine (C) en Thymine (T) - de bouwstenen van het DNA. De eindeloze rijen ATTGCGGGTCTAATCGGCGTTT's die uit de computers rollen, moeten de speurtocht naar genen en hun functies bespoedigen
De techniek is inmiddels zo goedkoop dat onderzoekers het erfelijk materiaal van steeds meer organismen willen sequencen. Zo is in september vlakbij Parijs Genoscope opgezet, een Frans nationaal sequencing centre dat met tachtig medewerkers en dertig sequence-machines de totale genomen van schimmels, bacterien, planten en de mens gaat sequencen. De Japanse regering maakte vorige maand bekend dat ze zwaar inzet op het sequencen van rijst (450 miljoen basenparen) en van de muis (drie miljard basenparen)
Van tien bacterien en van het bakkersgist is de complete erfelijke code al bekend. In 1998 volgen naar verwachting zo'n dertig bacterien. Het grootste sequencing-bedrijf ter wereld, het Amerikaanse Institute for Genomic Research (TIGR), heeft tenminste tien bacterien onder handen. Van het menselijk genoom (drie miljard basenparen) is nu zo'n drie procent gesequenced; in 2005 moet het klaar zijn. Van de zandraket, een modelplant met slechts honderd miljoen basenparen, zijn inmiddels zeventien miljoen basenparen bepaald
Concurreren
De techniek gaat ontzettend hard, zegt dr Willem Stiekema van het Centrum voor Plantenveredelings- en Reproductieonderzoek (CPRO-DLO), betrokken bij het sequencen van de zandraket. We zijn begonnen in 1993. Met 25 Europese groepen hadden we de eerste drie jaar nog maar 1,9 miljoen basenparen opgehelderd. Vorig jaar hebben we met minder groepen vijf miljoen basenparen gedaan. De Amerikanen hebben afgelopen twee jaar zeven miljoen basenparen ontrafeld en de Japanners vijf miljoen. In 2001 verwachten we klaar te zijn.
Het sequencen van de zandraket is, net als het humane genoomproject, een internationaal megaproject. De Europese groepen worden gefinancierd en gecoordineerd door de EU. De Europeanen sequencen chromosoom vier en samen met de Japanners chromosoom drie en vijf; het Amerikaanse bedrijf TIGR en twee Amerikaanse universiteiten doen chromosoom twee. Tot 1996 waren er 25 Europese groepen die meededen, nu zijn het er nog tien. Er zijn flink wat universitaire groepen en kleine bedrijven afgevallen omdat het voor hen niet meer lonend was. Aanvankelijk betaalde de EU per opgehelderd basenpaar nog 1,6 ecu, ongeveer drie gulden; volgend jaar is dat nog maar een halve ecu
Het CPRO wil blijven concurreren in het sequencen van planten. Voor de zandraket heeft het vier medewerkers aangesteld, onder wie een bio-informaticus voor de analyse van de gegevens. Met plantenveredelaar prof. dr ir Evert Jacobsen van de Landbouwuniversiteit wil het centrum nu ook beginnen met het sequencen van het aardappelgenoom (een a twee miljard basenparen). Een logisch vervolg op het samen genetische kaarten maken en het zoeken naar belangrijke genen, vindt Stiekema. Onduidelijk is nog welke vorm dit nieuwe project krijgt. Mogelijk komt er een sequencing-bedrijf in Wageningen
Internet
Nog maar vijf jaar geleden vonden nogal wat moleculair biologen het sequencen van totale genomen een onnodig kostbare operatie. Deze critici hadden meer vertrouwen in de klassieke aanpak om genen op te helderen: je bepaalt de verschillen tussen individuen in bijvoorbeeld kleur, bloeiwijze of ziekteresistentie, vervolgens isoleer je de verantwoordelijke eiwitten en vertaal je die terug naar het DNA
Inmiddels is echter duidelijk dat zo duizenden genen niet worden gevonden. Veel genen komen immers maar zelden tot expressie; andere zorgen voor de aanmaak van zo weinig eiwitten dat de onderzoekers deze eiwitten niet vinden. Bovendien kost het op die manier isoleren van genen erg veel tijd
Het verlaten van deze klassieke aanpak zet het werk van de moleculair biologen op zijn kop. Ze gaan niet meer uit van fysiologische verschillen om genen op te helderen, maar van computerresearch. Momenteel verschijnen per dag zo'n honderdduizend nieuwe basenparen op Internet. Daarin zitten soms tientallen genen, die te herkennen zijn aan bepaalde stukjes basenvolgorde. De onderzoekers speuren dan naar zogeheten kandidaatgenen, die mogelijk zijn betrokken bij de fysiologische functies die zij onderzoeken. Een onbekend gen van de zandraket promoveert bijvoorbeeld tot kandidaatgen wanneer het lijkt op een bloei-inducerend gen dat de onderzoekers al hebben geisoleerd
Een groep mag kosteloos kandidaatgenen onderzoeken die ze op Internet heeft gevonden, want genen met een onbekende functie kunnen niet kunnen worden gepatenteerd. Al die informatie op Internet is momenteel de belangrijkste spin-off van deze sequence-projecten, concludeert Stiekema
Genoom Bacillus subtilis geheel ontrafeld
Een complete basenvolgorde kan verrassend nieuwe inzichten geven in de organisatie van het erfelijk materiaal. In november publiceerde Nature de complete basenvolgorde van het genoom van Bacillus subtilis, een bacterie die industrieel belangrijke enzymen maakt. Opmerkelijk was dat de helft van de 4100 genen een of meerdere duplicaten heeft. Een type gen heeft zelfs 77 duplicaten. Al deze 77 genen coderen waarschijnlijk voor transporteiwitten, die betrokken zijn bij opname van voedingsstoffen of bij de uitscheiding van antibiotica. Communicatie met de omgeving is blijkbaar erg belangrijk voor deze bacterie, zegt dr Sierd Bron, kenner van B. subtilis aan de Rijksuniversiteit Groningen
Een andere verrassing was dat zich in het genoom van B. subtilis maar liefst tien bacterievirussen hebben genesteld. Een belangrijk gegeven voor het evolutieonderzoek, aangezien bacterievirussen betrokken zijn bij de overdracht van genen tussen bacterien. Het vergelijken van het B. subtilisgenoom met andere ontrafelde genomen levert straks nog veel meer informatie over evolutie op, verwacht Bron. We leven in een heel spannende tijd.
Van achttienhonderd van de 4100 genen van B. subtilis is nog onduidelijk wat ze doen. Maar dat zal niet lang meer duren. Het onderzoek naar de functies hiervan wordt door de EU bijna industrieel georganiseerd. Ieder deelnemend laboratorium krijgt een stuk van het genoom toegewezen, vertelt Bron. De onbekende genen in jouw segment schakel je heel gericht een voor een uit. Voor elke bacteriestam met een uitgeschakeld gen betaalt de EU vijfhonderd ecu, zo'n duizend gulden. Alle mutanten worden centraal verzameld en door alle deelnemers op bepaalde fysiologische afwijkingen onderzocht. Wij screenen alle mutanten op eiwitsecretie; anderen screenen ze op stress-resistentie of op stofwisselingsstoornissen. Blijkt een mutant gestoord in bijvoorbeeld stofwisselingsstoornissen, dan is de kans groot dat het geblokkeerde gen hierbij betrokken is.
De Europese industrieen krijgen inzage in de gegevens voordat ze worden gepubliceerd. Vindt een bedrijf een gen interessant, dan kan het in zee gaan met betrokken groepen. Bron verwacht dat bedrijven in ruil voor het recht op patenten bij deze groepen vervolgonderzoek zullen financieren
Kippenonderzoekers steunen op humane genoomproject
We werken steeds meer vanachter het beeldscherm, zeggen dr Jan van der Poel en dr Martin Groenen van het Centrum voor dierlijke genoomanalyse, gehuisvest bij de leerstoelgroep Fokkerij en genetica. Het Wageningse centrum heeft zich met hulp van kippenfokker Euribrid ontwikkeld tot een vooraanstaand laboratorium in de genoomanalyse van kippen
Het sequencen van hele genomen van landbouwhuisdieren is te duur. Maar de moleculair onderzoekers steunen wel steeds zwaarder op het systematisch sequencen van het menselijk genoom. Groenen: Soms zitten we hele dagen informatie te bekijken. Zo gauw we op het Internet een menselijk gen vinden dat mogelijk interessant is voor ons, gaan we ermee aan de slag.
Grote gebieden van het genoom in mensen zijn hetzelfde georganiseerd als in landbouwhuisdieren; ook de genen lijken op elkaar. En dat schiet lekker op. Zo hebben de Wageningers in het kippengenoom en in het varkensgenoom, dat ze ook onderzoeken, een aantal regio's gevonden waar waarschijnlijk genen liggen die betrokken zijn bij vetaanzet. De genen zijn echter nog niet bekend. Een promovendus vergelijkt nu de bij het varken gevonden regio's met overeenkomende regio's op de genetische kaart van de mens. Wellicht liggen er in die regio bij de mens al opgehelderde genen die bij vetaanzet betrokken kunnen zijn. In dat geval kan de groep nagaan of deze genen ook bij varkens verantwoordelijk zijn voor verschillen in vetaanzet
In het kippengenoom vond het centrum regio's die betrokken zijn bij ziektes zoals salmonellosis en ascytus. Ascytus is een dodelijke ziekte, kenmerkend voor de moderne, snelgroeiende kippen van tegenwoordig. Selectie op kippen die minder gevoelig zijn voor ascytus is nu nog te duur, zo verdedigen Groenen en Van der Poel hun onderzoek. Maar wanneer betrokken genen eenmaal bekend zijn, is al in een vroeg stadium van kippengroei hierop te selecteren. Daardoor wordt het fokken van minder gevoelige kippen wel rendabel.
Zonder samenwerking met Euribrid had het centrum internationaal geen positie in het genoomonderzoek, verzekeren Van der Poel en Groenen. De samenwerking heeft echter wel een prijs. De groep mag niet alles meteen publiceren. Groenen: Net deze week heeft het blad Genomics onze gedetailleerde genenkaart van het kippengenoom voor publicatie geaccepteerd. Op die kaart staan dan wel al onze markers (herkenbare basenvolgordes die de regio's in het genoom afbakenen, red.), maar niet de bij ziekte of vetaanzet betrokken regio's die aan die markers zijn gekoppeld. Dat ligt heel gevoelig.
Genoomonderzoekers houden gevoelige informatie soms wel een paar jaar voor zich. Volgens Van der Poel en Groenen vertraagt dit het onderzoek wel wat, maar is het geen groot probleem. Er is voldoende spin-off die je wel kunt publiceren. Bovendien, ook met die geheimhouding komt nog steeds veel meer relevante informatie vrij dan we kunnen verwerken. Hele stukken genoom worden immers blind gesequenced en integraal op het net gedumpt.

Re:ageer